LIC cloning

DESIGN:

Ligation Independent Cloning (LIC) uses the 3′ exonuclease activity of T4 DNA Polymerase to chew back constructs to a particular base, and then uses the resulting sticky ends to paste a gene into the correct place in a vector.  This is followed with transformation to bacteria to repair the nicked strands and make more DNA.

T4 DNA polymerase has 3′ exonuclease activity: in the absence of NTPs, it will chew back the 3′ end of double stranded DNA.  This reaction competes with the addition of bases in the 5′-3′ direction on the same strand.  If we add a large number of dNTPs, the polymerase activity will overwhelm the exonuclease activity and the 3′ end will extend.  Things get interesting if we add only a single dNTP.  Let’s say we add dGTP.  The polymerase will chew back until it reaches a “C” on the opposite strand.  It will then incorporate the dGTP.  There is then a competition between the exonuclease — going backwards — and  adding the G — going forwards.  As long as there is dGTP around, the polymerase will sit stalled at that position.  By carefully designing a DNA construct, one can use this stalling behavior to create long sticky ends to paste DNA together.

Vector prep:

Our vector (derived from pET28/30) has an SspI site that cuts in the following location.  The soon-to-be sticky ends are blue and green; the “G” at which the polymerase stalls is shown in bold red.

                       SspI
---AACCTGTACTTCCAATCCAAT|ATTGGAAGTGGATAACGGATC---                     
---TTGGACATGAAGGTTAGGTTA|TAACCTTCACCTATTGCCTAG---

After SspI digest and T4 DNA polymerase reaction with only dGTP (the '.' indicates the base is gone):

5'-AACCTG.....................ATTGGAAGTGGATAACGGATC-3'
3'-TTGGACATGAAGGTTAGGTTA.................... GCCTAG-5'

Insert Prep:

To create an insert for LIC cloning, we amplify our gene of interest using primers that have special LIC ends (bold) that will be complementary to the vector LIC ends.  The other end of each primer is complementary to our gene of interest.

F: 5’-TACTTCCAATCCAATGCG-[5' end of your gene]-3'
R: 5'-TTATCCACTTCCAATGCGCTA-[Reverse-complement of 3' end of your gene]-3'

Which yields the product:

5’-TACTTCCAATCCAATGCG--YOUR-GENE--TAGCGCATTGGAAGTGGATAA-3'
3’-ATGAAGGTTAGGTTACGC--YOUR-GENE--ATCGCGTAACCTTCACCTATT-5'

Do T4 DNA polymerase reaction with only dCTP, which will chew back the 3′ ends until the reaction hits the first C (bold red):

5’-TACTTCCAATCCAATGCG--YOUR-GENE--TAGCGC...............
3’-...............CGC--YOUR-GENE--ATCGCGTAACCTTCACCTATT

Note the long length of the vector and insert that are complementary (blue and green).  The last step is to anneal the vector and the insert and then transform into bacteria to repair breaks.

VECTOR INFORMATION:

MBP LIC vector sequence
MBP LIC vector map

Sequencing primers:
MalE (forward): GGTCGTCAGACTGTCGATGAAGCC
T7Term (reverse): GCTAGTTATTGCTCAGCGG

PROTOCOL:

I. Vector Prep:

1. Cut vector (5 ug) with SspI in 150 uL volume for ~2 hours @ 37 C.
2. Clean-up using Qiagen PCR Kit into 50 uL.
3. Perform dGTP vector overhang reaction

In thermocycler, incubate at 22 °C for 30 minutes, 75°C for 20 minutes and 4°C for 5 minutes

II. Insert Prep:

1.  PCR amplify insert using special LIC cloning primers.
2.  Digest PCR product with 1 uL DpnI for 1-2 hours @ 37°C to remove template vector (if it contains Amp-resistance gene).
3.  Clean up DpnI-digested PCR product with Qiagen PCR Kit – 30 uL
4.  Phosphorylate PCR product

In thermocycler, incubate at 37°C for 1.5 hr, 65°C for 20 minutes and 4°C for 5 minutes

5.  Perform dCTP PCR product overhang reaction

In thermocycler, incubate at 22 °C for 30 minutes, 75°C for 20 minutes and 4°C for 5 minutes

III. Anneal and transform

1. Combine 20-30 ng of treated vector (1 uL or less) with 30 ng of treated PCR product (3 uL of 50 uL reaction above)
2. Incubate for 20 minutes @ RT
3. Transform (25 uL XL-10 gold cells + 2 uL annealed DNA), put onto an ampicillin plate, and keep overnight at 37 °C.

IV. Verify success

1. Prep plasmids from 3 colonies.
2. Perform a restriction digest with XbaI/HindIII.  Without an insert, this will yield a 1,289 bp and 5,134 bp product.  Your insert will increase the size of the short fragment (e.g. for a 300 bp gene, you would get a 1,589 bp short fragment).   
3. Sequence one of the apparently good clones using the MalE forward and T7Term reverse sequencing primers.